// Compose produces a composition of the receiver defined by the features in fs. The result is stored
// in the receiver and all contributing sequences are modified.
func (m *Multi) Compose(fs feat.Set) error {
m.Flush(seq.Start|seq.End, m.Alpha.Gap())
for _, r := range m.Seq {
err := sequtils.Compose(r, r, fs)
if err != nil {
return err
}
}
return nil
}
func ExampleSeq_Compose() {
s := NewSeq("example DNA", []alphabet.Letter("aAGTATAAgtcagtgcagtgtctggcag<TS>gtagtgaagtagggttagttta"), alphabet.DNA)
f := fs{
fe{s: 0, e: 32},
fe{s: 1, e: 8, st: -1},
fe{s: 28, e: s.Len() - 1},
}
fmt.Printf("%-s\n", s)
if err := sequtils.Compose(s, s, f); err == nil {
fmt.Printf("%-s\n", s)
}
// Output:
// aAGTATAAgtcagtgcagtgtctggcag<TS>gtagtgaagtagggttagttta
// aAGTATAAgtcagtgcagtgtctggcag<TS>TTATACT<TS>gtagtgaagtagggttagttt
}